StemCET Logo

Biology Question 194 – NEET-UG 2023

← Back
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG AUCG AUCG 3'?
✨
✨
🪄
✨

Ready to master this concept? 🚀

Get 100% free access instantly! Sign in using your existing Google account—no new passwords or registration required. Instantly unlock step-by-step solutions, clues, and full explanations.

No thanks, back to home →
🥷
Ninja Strategy•Coding Strand Properties

The coding strand has the same sequence as mRNA (with T instead of U) and the same 5' to 3' direction. Quickly check options for 'T' instead of 'U' and correct directionality.