Biology Q178 – NEET-UG 2024 | StemCET

STEM Learning Console

Home Biology Molecular Basis of InheritanceQuestion #263

Which one is the correct product of DNA dependent RNA polymerase to the given template?

3^{'} TACATGGCAAATATCCATTCA 5^{'}

✨

✨

🪄

✨

Ready to master this concept? 🚀

Get 100% free access instantly! Sign in using your existing Google account—no new passwords or registration required. Instantly unlock step-by-step solutions, clues, and full explanations.

No thanks, back to home →

🥷

Ninja Strategy•Direct Transcription & RNA Specificity

Directly transcribe the DNA template to RNA using correct base pairing and directionality, then eliminate options that are DNA or have incorrect sequences.